Logo

The Human Genomics Community

hg38
hg38
hg19
rs746753722
NM_017882.3(CLN6):c.679G>A
SYNGR1:c.607_608insACA
BRAF:V600E
5:156479558:15:
7-151945072--T
5:156479558
BRAF
NM_002482
chr2:47630263:47639699:DEL
AGTCCRAGTTGTAAATGGTACACTCGGCGTAAGCCTGAAAAGATAAAATCAAAGATGTAAAGGTGAGCACAGTCTAAGTTCTCTCTGAAGTGTCAATGGGAATGCAGATTGGATTAAATAAATGCTGCCCAAGTGCATACTCAAAGAGGC
Recent VarSome activity
 Athina Mourtzaki linked the publication CRISPR Repair Reveals Causative Mutation in a Preclinical Model of Retinitis Pigmentosa.​ to PDE6B(NM_000283.4):c.1041C>A
 Ioannis Liopetas linked the publication Novel RAB3GAP1 compound heterozygous mutations in Japanese siblings with Warburg Micro syndrome.​ to RAB3GAP1(NM_012233.3):c.1009C>T
 Ioannis Liopetas linked the publication Novel RAB3GAP1 compound heterozygous mutations in Japanese siblings with Warburg Micro syndrome.​ to RAB3GAP1(NM_012233.3):c.560G>C
 Ioannis Liopetas linked the publication The Role of ORAI1 in the Odontogenic Differentiation of Human Dental Pulp Stem Cells.​ to ORAI1(NM_032790.4):c.322G>C, chr12-121641053-G-C
 Athina Mourtzaki linked the publication Congenital disorder of glycosylphosphatidylinositol (GPI)-anchor biosynthesis--The phenotype of two patients with novel mutations in the PIGN and PGAP2 genes.​ to PIGN(NM_176787.5):c.932T>G
 Athina Mourtzaki linked the publication Congenital disorder of glycosylphosphatidylinositol (GPI)-anchor biosynthesis--The phenotype of two patients with novel mutations in the PIGN and PGAP2 genes.​ to PIGN(NM_176787.5):c.790G>A
 Athina Mourtzaki linked the publication Congenital disorder of glycosylphosphatidylinositol (GPI)-anchor biosynthesis--The phenotype of two patients with novel mutations in the PIGN and PGAP2 genes.​ to PGAP2(NM_014489.4):c.2T>G
 Ioannis Liopetas linked the publication Expanding the SPECC1L mutation phenotypic spectrum to include Teebi hypertelorism syndrome.​ to SPECC1L(NM_015330.6):c.1198_1203del
 Athina Mourtzaki linked the publication Congenital disorder of glycosylphosphatidylinositol (GPI)-anchor biosynthesis--The phenotype of two patients with novel mutations in the PIGN and PGAP2 genes.​ to PGAP2(NM_014489.4):c.404G>A
 Athina Mourtzaki linked the publication Molecular and phenotypic characteristics of seven novel mutations causing branched-chain organic acidurias.​ to BCKDHB(NM_183050.4):c.410C>T
 Mendel Roth [Genben Lifesciences] classified PPARG(NM_138711.6):c.1045G>A as Uncertain Significance
 Mendel Roth [Genben Lifesciences] classified LCAT(NM_000229.2):c.523+2T>A as Likely Pathogenic
 Mendel Roth [Genben Lifesciences] classified PCSK9(NM_174936.4):c.100G>C as Uncertain Significance
 Nelmar Valentina Ortiz Cabrera [Niño Jesús University Childrens Hospital] classified STK11(NM_000455.5):c.920+5G>A as Likely Benign
 Alexej Knaus [University Hospital Bonn] classified COL3A1(NM_000090.4):c.529-14A>G as Pathogenic
 Irina Mersiyanova [Dmitry Rogachev National Medical Research Centre] classified SMARCD2(NM_001098426.2):c.567+5G>A as Likely Pathogenic
 Mendel Roth [Genben Lifesciences] classified NOS3(NM_000603.5):c.2414A>C as Uncertain Significance
 Mendel Roth [Genben Lifesciences] classified CETP(NM_000078.3):c.464_467del as Likely Pathogenic
 Nelmar Valentina Ortiz Cabrera [Niño Jesús University Childrens Hospital] classified ROR2(NM_004560.4):c.1398dup as Pathogenic
 Nadide Cemre Zubari [EuroGene] classified EMC10(NM_206538.4):c.431del as Pathogenic