Logo

The Human Genomics Community

hg38
hg38
hg19
rs746753722
NM_017882.3(CLN6):c.679G>A
SYNGR1:c.607_608insACA
BRAF:V600E
5:156479558:15:
7-151945072--T
5:156479558
BRAF
NM_002482
chr2:47630263:47639699:DEL
AGTCCRAGTTGTAAATGGTACACTCGGCGTAAGCCTGAAAAGATAAAATCAAAGATGTAAAGGTGAGCACAGTCTAAGTTCTCTCTGAAGTGTCAATGGGAATGCAGATTGGATTAAATAAATGCTGCCCAAGTGCATACTCAAAGAGGC
Recent VarSome activity
 Athina Mourtzaki linked the publication A New Variant of PKLR Gene Associated With Mild Hemolysis may be Responsible for the Misdiagnosis in Pyruvate Kinase Deficiency.​ to PKLR(NM_000298.6):c.1708G>T
 Athina Mourtzaki linked the publication Recurrent pulmonary embolism associated with deep venous thrombosis diagnosed as protein s deficiency owing to a novel mutation in PROS1: A case report.​ to PROS1(NM_000313.4):c.1792G>T
 Athina Mourtzaki linked the publication A novel homozygous mutation in POLR3A gene causing 4H syndrome: a case report.​ to POLR3A(NM_007055.4):c.2423G>A
 Athina Mourtzaki linked the publication A Novel PGM3 Mutation Is Associated With a Severe Phenotype of Bone Marrow Failure, Severe Combined Immunodeficiency, Skeletal Dysplasia, and Congenital Malformations.​ to PGM3(NM_015599.3):c.1135T>C
 Ioannis Liopetas linked the publication Polo-like kinase 2 modulates α-synuclein protein levels by regulating its mRNA production.​ to SNCA(NM_007308.3):c.307-2539T>G
 Athina Mourtzaki linked the publication Residual pyruvate kinase activity in PKLR-deficient erythroid precursors of a patient suffering from severe haemolytic anaemia.​ to PKLR(NM_000298.6):c.583G>A
 Ioannis Liopetas linked the publication Novel STAC3 Mutations in the First Non-Amerindian Patient with Native American Myopathy.​ to STAC3(NM_145064.3):c.432+4A>T
 Ioannis Liopetas linked the publication Novel STAC3 Mutations in the First Non-Amerindian Patient with Native American Myopathy.​ to STAC3(NM_145064.3):c.862A>T
 Athina Mourtzaki linked the publication Molecular basis of pyruvate kinase deficiency among Tunisians: description of new mutations affecting coding and noncoding regions in the PKLR gene.​ to PKLR(NM_000298.6):c.966-1G>T
 Ioannis Liopetas linked the publication Sepiapterin reductase deficiency: Report of 5 new cases.​ to SPR(NM_003124.5):c.1A>G
 Mendel Roth [Genben Lifesciences] classified PPARG(NM_138711.6):c.1045G>A as Uncertain Significance
 Mendel Roth [Genben Lifesciences] classified LCAT(NM_000229.2):c.523+2T>A as Likely Pathogenic
 Mendel Roth [Genben Lifesciences] classified PCSK9(NM_174936.4):c.100G>C as Uncertain Significance
 Nelmar Valentina Ortiz Cabrera [Niño Jesús University Childrens Hospital] classified STK11(NM_000455.5):c.920+5G>A as Likely Benign
 Alexej Knaus [University Hospital Bonn] classified COL3A1(NM_000090.4):c.529-14A>G as Pathogenic
 Irina Mersiyanova [Dmitry Rogachev National Medical Research Centre] classified SMARCD2(NM_001098426.2):c.567+5G>A as Likely Pathogenic
 Mendel Roth [Genben Lifesciences] classified NOS3(NM_000603.5):c.2414A>C as Uncertain Significance
 Mendel Roth [Genben Lifesciences] classified CETP(NM_000078.3):c.464_467del as Likely Pathogenic
 Nelmar Valentina Ortiz Cabrera [Niño Jesús University Childrens Hospital] classified ROR2(NM_004560.4):c.1398dup as Pathogenic
 Nadide Cemre Zubari [EuroGene] classified EMC10(NM_206538.4):c.431del as Pathogenic